Oparty na otyłości wariant genu FTO i zwiększone spożycie energii u dzieci ad

Zbadaliśmy także rolę rs9939609 w kontroli wydatku energetycznego i zachowań żywieniowych w intensywnie analizowanej podgrupie tych dzieci. Metody
Przedmioty
Uczestnikami badania byli przedszkolni uczniowie, w wieku od 4 do 10 lat, z północno-wschodniej Szkocji, z których większość była pochodzenia europejskiego (95%). Zostali oni zwerbowani ze Studium Bilansu Energetycznego, badania związków fenotypowych i genotypów w utrzymywaniu równowagi energetycznej u dzieci.12-14 Genomowy DNA został wyizolowany z próbek śliny wszystkich osobników po tym, jak rodzice lub opiekunowie wyrazili pisemną, świadomą zgodę, a dzieci udzieliły zgody. Zatwierdzenie Bilansu Bilansu Energetycznego zostało przyznane przez Komisję Tayside ds. Etyki Badań Medycznych i Lokalny Komitet Badawczy Fife. Dział edukacji w każdej szkole (lub dzielnicy) oraz dyrektorzy szkół (lub dyrektorzy szkół) również wyrazili na to zgodę.
Genomowy DNA od 2726 dzieci był dostępny do genotypowania w celu powiązania wariantu genu FTO będącego przedmiotem zainteresowania z nadwagą i otyłością. Do oceny otyłości, wydatków energetycznych i zachowań żywieniowych dostępna była podparta próba 97 dzieci. Dzieci te zostały zwerbowane z podpróbki Bilansu Energetycznego, prospektywnie wzbogaconego o warianty genu receptora aktywowanego proliferacją peroksysomów, PPARG. 14
Genotypowanie
Wariant SNP rs9939609 został genotypowany za pomocą testu allelic dyskryminacji (Custom TaqMan MGB, Applied Biosystems) z detektorem 7700 (Applied Biosystems). Sekwencje składników testu były następujące: przedni primer, CTAGGTTCCTTGCGACTGCT; reverse primer, ACCTATTAAAACTTTAGAGACACAGACTATCCA; sonda 1, VIC-CATCACAAAATTCAC-BHQ i sonda 2, FAM-CATCACTAAATTCAC-BHQ.
Pomiary antropometryczne
Data urodzenia została ustalona. BMI obliczono jako wagę w kilogramach podzieloną przez kwadrat wysokości w metrach. Wysokość stania bez butów została zmierzona (z dokładnością do 0,1 cm) za pomocą stadiometru (Leiomester Stadiometer, Seca). Masę ciała w odzieży lekkiej mierzono (do 0,1 kg) za pomocą mechanicznej wagi podłogowej (Seca). Obwód w pasie (do najbliższego 0,1 cm) mierzono w pozycji stojącej, w połowie drogi między grzebieniem biodrowym a dolnym brzegiem nadgarstka. Obwód biodra (do najbliższego 0,1 cm) mierzono w pozycji stojącej na maksymalnym obwodzie ponad pośladkami. Pomiary antropometryczne obejmowały bicepsy, triceps oraz podskórne i nadolbrzymi fałdy skórne. Suma pomiarów fałd skórnych została użyta do oszacowania masy tłuszczowej i beztłuszczowej za pomocą równania Lohmana.15,16 Wszystkie pomiary fałdów skórnych zostały wykonane po prawej stronie ciała przez tego samego badacza.
Pomiar spożycia pokarmu podczas posiłku testowego
Procedura pomiaru poboru pokarmu podczas posiłku testowego została opisana w innym miejscu. [14] Krótko mówiąc, trzykrotnie w szkole, 1,5 godziny przed obiadem testowym, dzieci spożywały napój lub połączenie żywności i napojów, które różniły się energią. gęstość: kontrola bezenergetyczna składająca się z 250 ml wody (0 kJ), niskoenergetycznego połączenia 250 ml napoju pomarańczowego i 56 g muffiny (783 kJ) oraz kombinacji wysokoenergetycznej 250 ml pomarańczowy napój i 56-g muffinki (1628 kJ)
[więcej w: dentysta bydgoszcz, dentofobia, chirurgia dentystyczna ]

Powiązane tematy z artykułem: chirurgia dentystyczna dentofobia dentysta bydgoszcz